EST 924656 is a singleton


Sequence

>924656 (1 EST) Length=482 GTCATTATGGGTAAAGCTAAATTAAGGATAAAAGATGCATCAAAAAGTAATGGCAATATGCAAGCCCTTCCTTTCAATAT TGATCGTGGTCAGCACATTTTGAAGAATCCGGGAATTGTTAATGCCATTGTTGAAAAGTCAGCAATCAAATCAACGGATA CTGTTTTCGAAGTTGGATCTGGTACTGGTAATTTGACAGTAGCGCTTTTAGGAAAAGCTAAAAAGGTGATTGCATGCGAA ATTGATCGACGGATGATCGCTGAACTGAAAAAACGAGTGATTGGAACATCAAATCAGCAAAAACTGGAAGTGAGACAAGG AGATGTTATAAAAACGGAATGGCCTTTTTTTGATGTGTGTGTTTGCCAATCTACCCGTATCAGATCTCATCGCCCTTTGT ATTTAAGCTGTTATTGCAGCGGCCCTTGCCTAAATATGCTGTATTAATGTTCCCAAAGGAATTTGCGGATCGATTATTAC CA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 924656: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9246561927226AA283568SW3ICA2714SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 8:40:58 on Fri 24 Nov 117.