EST 924660 is a singleton


Sequence

>924660 (1 EST) Length=457 TTTCGGATGAAACATTCACAACAATTCTGCATCCATTTGACCCACCTTGAAGGACAGCCTTAATTAACAGTCACTGCACT TATCTTGATTGTATATGATTATATATGTCGCCTTGAGTAGTAATTTCAAGCGAGATTTCCCTNGAATAAGAAGACTAATT TTTCTTCCAGAAATATTCATGTTGAACAATTTTCGTTTTTTTGATGAACCCAGAAGGGTGTCAATACGATCCATTATACG GCTACACACAACCACAAGCACGAATAACGGCAGCGCCGGATATAACGACTTTAACACCTTTTGCACCTCAAGCAACTCCT CTTGGAGAATATTCATCCGCGCATGCCCTTTCTACTTATGATCCGTATAGATATCCGTCCTATTACCCATCATACGGCCC CACTACTGGTTCCACATCTTTCTATACCACAGATTTAACATCGTTTTCGACAAATCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 924660: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9246601927230AA283572SW3ICA2721SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 13:53:24 on Mon 20 Nov 117.