EST 924670 is a singleton


Sequence

>924670 (1 EST) Length=466 TCGTGACTGGCTTTTCACGGAAGAACAACTTGCAAATACGCCGTCTAGAAGAGGTGGAGTTGACCGTGTTGAAGAAGACA AGTTGCGAAGAGAGGGAATCAAGCTTATTGTTGAAATTGGCAGTGGTTTAAAGCTGCAGCCAAATCCAACGTTGGCAACA GCAGCTGTTTATTTTCATCGTTTCTACATGTTTCATTCTTTCAAAGAATTCCAGAAGCATCTGACAGCTGTGGGTTGTCT ATTCCTGGCTGGAAAGGTCGAAGAGACACCAAAAAAGTGCAGAGACATTATACTGATTGCAAAAGAAAAGTACCCTGATT TGTACAGTATGAAAAATGCAATTGAGGAGGTAATGGGTATTGAACGAGTTCTTTTGCAAACAATTAATTTCGATCTTCAT GTTAGATCATCCATATACGTTTCTCTTGCAATACCAGAAGGTTTTTAAGTTAGATCGCGAAAAAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 924670: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9246701927240AA283582SW3ICA2738SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 19:12:36 on Wed 22 Nov 117.