EST 924673 is a singleton


Sequence

>924673 (1 EST) Length=406 CGGCACGAGGCGCTTAGCAACTTGTCACATTAATAATGATAGAATACTTAGCAATTATCATTATCATTAGCTATCATCTA CTTAATAATTTATTCTTGTGTTCTTTGGAACGTAAACAATCAATAAATTACCACATGACAAGACAAGCATATGCAGGCCA CAATAATTGTCCTCATTATCGGTGAATTATGGCTTTACTGATTCAAATAATATTTATTGGAGGTAATGAATACCTAACAT ACCTTTTTCACTTTTTCTTCTTTCTCTCTTCACTCCTTCAGCTTTCTTTTCTCCCTACATTTCATTATCTGGTTGGTCAA GTTGAATGTGTCGGCTTGTGTTTGCTTTTGTCAGAACTTCAAAACTTCTGCTTTCATTTAATTCTTACTTCATTCTATAC CACAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 924673: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9246731927243AA283585SW3ICA2742SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 9:48:35 on Fri 24 Nov 117.