EST 924681 is a singleton


Sequence

>924681 (1 EST) Length=655 TGAGAATTGGCAACAAACTATTCTCATTAACATGCATTTCATCTATTTATTCTTCTTTGTCTTCCAATTGAGCAATATTC GAAACACAGTAGCGCAAACGGAACAAACAGAACCGTNGGATTTATCAATATCAAAAGTGAAAGAGGAAGGAAATAAATCG CANGGCTTATCAGTGAAAAGAGTGAGTGATGAACGAATTAAACCGCGACGACTTGTTCCAATCGAAACACTGACGGAAGT AATTGAACCAGAAAAAGAAAGCACAGGAAAGAAACGGCGTTGTGATATATGTCAAAAGGAAATAACACATATGAAAAATC ATATGATGACTCATACTGCTGAAAAGCCGTATAGTTGTCCACTATGCAAGAGAAATTTCACTCAGTTCGGGAATATGAAA AAACATGTGATGATTCATACTGGTGAAAAGCCGTACAGTTGTTCGATATGCAAAAAGAATTTTATTCAGTCCAGCAGTAT GATAGCACATATGGTGGTTCATACCGGTGAGAAGCCGTACAGTTGTTCCATATGCAAAAAGAATTTCGGTGATCTCTGTA ATATGAAAAGGCATAAGAAGACCCTACTGGTGAAAAGCCGTATAGTTGTCCAGTTTGCCAGAAAAATTTCCCTCAATCCT GCCATTTNAAAAATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 924681: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9246811927251AA283593SWMFCA2160SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 6:11:23 on Sun 19 Nov 117.