EST 926289 is a singleton


Sequence

>926289 (1 EST) Length=167 TATGCAGGCCAATGTATTGAACTCGAACTTTCTTAAGTCCCTGATATGCCAATGTGTTAGCCTTTCTGATTTCCTCCTGT CCTCTTTGTTCCAACGTAAACACACACTCTGCCAGGTTGACGCCTGAACACAACTGATTTGAGACCTATTCGGTTGAGAG AAGGGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 926289: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9262891929516AA285197MS1AO002.AS6S. mansoni sporocyst Lambda gt11


Date: 4:30:14 on Wed 22 Nov 117.