EST 926291 is a singleton


Sequence

>926291 (1 EST) Length=296 AACAAAAGCCATTTTTACGCAAAGTACATGAAGATGGTATACAACCAATATTAGTCATTACAACTGTTCATAAAATTTAA TCGTGTATATCTGTAGTAAGTTCAGCCTACTGTGGGAGAGGATCAATCAACTTACAGATGAAAAAGAAATTAAGAAAAGG CACTGAAAGTGGATAGAATATATATGAGGAAATTATCAAACTGAATCACGAGGCAAGCTTGGAATGCTGATGAACGAAAG AGGAAGGATAGACTCTGCCGACGGAGCAACTGAAAGGATATAGCACTGAATATGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 926291: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9262911929518AA285199MA1AO004.ADES. mansoni adult Lambda gt11


Date: 22:17:44 on Sat 18 Nov 117.