EST 926293 is a singleton


Sequence

>926293 (1 EST) Length=234 AAACATCAAAAGGACTGATCAGTAAGTTATCCAACTGAAGGATCTCCACTCATTGTTGCTTCACCTTACATCTTGAATCG ATACTAACTTGTCCGGAGTTTTTTTTTAATTTTTCATGGAATTCCGCCGATACTGACGGCTCCAGGGATCCTCTAGCTAG TCGACCGTCAGGCATCAAGCTTGAGTATCTATAGTGTCACCTTAATAGCTTCTCAGTAACTATGGTCATAGCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 926293: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9262931929520AA285201MC1AO006.AEOS. mansoni cercarial Lambda gt11


Date: 23:58:52 on Sat 18 Nov 117.