EST 926295 is a singleton


Sequence

>926295 (1 EST) Length=280 ATCAATTACAAAATCAATGGAATTCAGTCGAACAACAAATGATTGAACGTTCAGAAAAATTAGATCAAATGTTATCTGGT ATACAAACTTTAAAAGAATTAGAACGTGATGTTGAACGAGAAATTAGTAAGACAGAAGCTGATTTACAAAGCGTTGATGC ATCAAAGAATCAATCGAATGATCAAAGTTTATCAACTTCTAGAATTCTTGTTATGACTCCAGAAACATGTCGTAAACACT TACAAGAACTAATCGATAGTTTGCCGCAAAGAAGTGCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 926295: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9262951929522AA285203MC1AO010.AEOS. mansoni cercarial Lambda gt11


Date: 16:33:35 on Sun 19 Nov 117.