EST 926299 is a singleton


Sequence

>926299 (1 EST) Length=217 CATAAAGAAAAGCGGGAAAGGAAAGCTCTCGCCTAGGCCCCCCTTGCAGAACCCGCTGTAACTGAAGCTCCTCTTGCCTA GAACCGTAGGCCCTAGCATGGTAAGCAAATAATTTATAAAGAAGAGCCGGTAGTTCGAGGAATATTCGGAGGCCTTAGGT GGAGAGATAATATAATCCTCGGAGGCATAAGCTGGATTTATCATCGCCTCGACATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 926299: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9262991929526AA285207MC1AO012.AEOS. mansoni cercarial Lambda gt11


Date: 13:48:49 on Thu 23 Nov 117.