EST 926302 is a singleton


Sequence

>926302 (1 EST) Length=244 GGAAGACCATCAAAAAGATAGAAATCAGCCAGCATGCTAAATACAACTGCAATTTTTGTGGGAAGGATTCGTTGAAAAGA AAAGCAGCTGGCATATGGGAATGCAAGGCGTGTAAAAAAGTAGTAGCTGGTGGCGCTTATGTTTGCAGTACAACGGCGGC GACAACAATTCGGGCTGCTATCAGGCGCTTGCGTGATGCCCACGAATCATAAACTATGTTTTAAAAAAATATAGTTGGTC TGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 926302: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9263021929529AA285210MC1AO015.AEOS. mansoni cercarial Lambda gt11


Date: 6:7:27 on Thu 23 Nov 117.