EST 926304 is a singleton


Sequence

>926304 (1 EST) Length=162 CTTGCCTCAATAACTAGCCAAGNTCGAGCAGCAGCGCAGCGATCACCGTACAGGNCCATCNCNTAGACATGANACCTTGT GANGGTGTTGGCACCGATTGGGCAGGAGCAAGAGCATCTATAGACTGCTTCGAGGACCCCTAAAGGAATTGAACTGATGA TT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 926304: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9263041929531AA285212MU1AO017.ALSS. mansoni Schistosomule Lambda Zap


Date: 22:13:7 on Fri 17 Nov 117.