EST 926305 is a singleton


Sequence

>926305 (1 EST) Length=163 CGATCAGAACTAAGGCGGAATCTGATCGCANNCGAAACTCTCACNGACGGCTNCTGATCAAAGAANNCACACATCGCAAA TCCTCAGGTGGTAGAAAGATCTGCGGAGCTGATCCCAANAGGTTTACACCAGTAACAGCCAGCCATCACGAAAGCCACGT TAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 926305: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9263051929532AA285213MU1AO018.ALSS. mansoni Schistosomule Lambda Zap


Date: 16:14:48 on Fri 17 Nov 117.