EST 926308 is a singleton


Sequence

>926308 (1 EST) Length=200 CCACGGAGATTGGTGTGTGTCGGGCCTTTGGTTCGGCGTTCGCCCACCGGGTTCAACGGAAACAACCTCGGAGACGTCCG CGAGAGTTCTGGGAAGAGTTNTCTTTAACTTTNTTAGGAGGTGCATCCACCCCCTGGAATCGGCTTGTACGGATGAATAG GGGGCTAGCCTACCGGTAAAAGCACCAACCCTTCGTTAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 926308: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9263081929535AA285216MU1AO021.ALSS. mansoni Schistosomule Lambda Zap


Date: 18:9:42 on Fri 17 Nov 117.