EST 935100 is a singleton


Sequence

>935100 (1 EST) Length=512 CAATGTTTGGTACATCAGTCGTATTCATACTACTTTCATCCAAAATTTTTCAACATTTTTTAGCATCATTTTTTGGTGTT AATATTAGCCTTTGTTATTTAATATGTGTTACAACCATTGCTATTATGCCACTTACATATCTGAAATCACCAGCTGATTT TTGGTTAGCAATTGTAATTGCAATGTTATGTACCGTTTTGGCCGTTTTATTGATTGCTTTAGGTATTAGCTTTGATATAA GCTCATGCATACCTGAAGCGCATTATCCGAAAGCTTCAATTAGTGGCGCAGTTGTCAGCTTAGGTACTTTTTTGTTTGCA TTTAGTGGTCATCAGGTATTTCCAACAATTCAACATGATATGTATCGTCCTATTGATTTCTCCAAATCAATCATTCTTGG CTTCTGTATTGTTACCTTCCTATATATGCCATTATCAATTTATGGTTACTTAACTTATGGTAGTAGCCATGCATAGTTCA ATAATTGATTCTGTTACAAACACCATGGATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 935100: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9351001941912AA293899SW3ICA2752SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 0:45:24 on Fri 24 Nov 117.