CBrugiaQ_10


Sequence

>CBrugiaQ_10 (13 EST) Length=894 TTNGGGGGGNTTTTTAAGGAAAANCCTTNAGGGNCCTTTTTTAAAACATNTTCCACAATNTNTTTNGGCAATTAATTGTG GGCCAGCAATAAAACGGGGAAAAAGGTGGCTNAAAAGGCNTNTTCATCTGGTTCCCTTCAAATAGGGCCCATATATTCGG CAACATGTTTTCCCAAGTATTTTTATCCAGGATGGGTTTCAGCATTGTATTTGGGTTTCCGGAATTATAACCCAAAGAAA GGGTTTCACTATGTGGAACATCGATACCACCATTCGGCAACACCCTTCATGACCGCGAAAACCTTAGCGCCTGTAACAGT GCGCGNTAACCCAACATCGAGAACAGCTCGGAAAGGTGTTCGTTCGCCTTCCTTTTCAACATTATAATCGTCACCAGTCG CTTCTTCCACACCTTTGTATGCTTCTGCTAGACCGATGTTGAGCAAATGACGTCGGGCCAACAATAAACCAGTGGCATAA GCTGATGCATAGTTGGTCAAGCCTACCTTAATCCCATAACGCGGTAACTCATGTGAGTATGCAGAACATACGACTACATC ACCCTCAATTCGAGAATATGCGATTTGAGCGATAACATCTCTGTTGGTGAAACGCACAATAAGACGATATTTTGGAGTGT TATATTTATTCTTGTCTTGCACAGTCAAACGTTTCCTCGCATAGTAATCCGTTTTACCCTCACGTCTACGCTTCAATTTC ACCTGGTAACGTTTGAAATAGGCCTTGTTCTTGACTACCTTCACGAATCCCATCCTACACTCTCAAACTCGTNCAAAATA TCGGCACGAACACTTCCCATTGAACCAGCGCACTTCGAACGTAAGACAAGTCTCGAACGTAACCCTTCTTCAACCTAAAC AGTGCCACACACTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_10: (13 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
299987914356H39275SWAMCA266SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
320253945454R86427SWAMCA404SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
320261945462R86435SWAMCA421SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5304721300222W23368SWAMCA603SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7062041592622AA072497SW3ICA1647SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7471971660807AA109311MBAFCE0F12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7473071660917AA109277MBAFCE2B10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8984061893011AA257281MBAFCZ1B1T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10751772113654AA430858RRAMCA347SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11536672246881AA509004MBAFCX6B04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11539072247121AA509244MBAFCX9A04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12774342429576AA598383SWMFCA2947SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
13247742539417AA627030MBAFCW2F12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 23:4:33 on Fri 24 Nov 117.