CBrugiaQ_1002


Sequence

>CBrugiaQ_1002 (2 EST) Length=491 TTTGACATCTCGTGTCTAGTTTCTTCCGAGTTTTGGCAAGAGCCCGTTATGGAGCGGCGATATCTGCGACCCAATGAACG TTATCCAGTCCCACTGGATGAAAGTTTCTGGACGAATATCGTATGCACCAGTAGTATAGGGCGAAGTGCCGCAGTTGCGC ATGAGCTTGATCGGATGCATACGTCGAATGTTGTGGCTGAAGTTTGAAAAAGAGCTCTTCGAGAGAAACAAAGAGGATAT CAACGATGCTATCATGAAACAGATAGCACCTTCAGCGGTAAATGTTTACGGGAATTCAGTACGAAAAATTTGATAAGCTT GAGTTTCGATCATGATGAATTAATAAGAACAGGGAAGAAAATAGAACGAAAGAACGAAATGCGTTGAAAGGGATCATCCA GTGCTGCACTCCAGAAAAAGAATAATGAATGAATAGAATAATTTTTTTCCAGTTTATTTTTAAAAGTTGAACTACTTTAC AATATTGAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1002: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6676191537099AA051932SWMFCA569SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11539412247155AA509278MBAFCX9D09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 8:51:23 on Fri 24 Nov 117.