CBrugiaQ_1006


Sequence

>CBrugiaQ_1006 (2 EST) Length=492 AAACGACTTGCTGCTCGTGCTGCTAAACAAGCTAAAAAGAAGCTGTCGAAGCAGAGACCAAAAAAAATCTGGAGATGGTA CATTTAGTCAGAGGACTGGTGCTATCAGTGGAGAATATTCTCAAAAGAGGACTGCGATCTCGCAAAACTTAAAGATTTTT TCAAACAGTTCGGCGATGTTCAGTATGTTGTATACGAAAAGGGAGATGAAAAGGCTCAAATTCGTTTTGGTGGTGAAGAA AACGGTGCTGCTATTGCATGGAAGGTAGCAACAGAAAAAGGAGAAGATGGAAAAGTTATGTTTGGTGGGAATGAGCTTAA GGGAACTGTGCTTGAAGGTGAGGAAGAAGAAGAATACTGGAATAACTTCAGCAAAAAGAAAGCTGATAAGCAAGCACGGA TAGCAAAAAATCGACGAAGAACTAAGGTTCGAGGTCGTGGTCCAAGGCGAAATGGTCCACGGAATGGTGTGACACGAGGC GAAAAGAGATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1006: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7523331668317AA114473MBAFCE4H06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8854721876876AA246068SWMFCA1183SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 12:53:28 on Sun 19 Nov 117.