CBrugiaQ_1009


Sequence

>CBrugiaQ_1009 (2 EST) Length=526 TTCATCAAGTGGCATCATTAATCGAGCCAAACTGGGGCATGTTTGAAACCATCAAATATCTAGGCATCGTTCAGGTGTAA TTTTTATGCTGTATCATTTTAAGCGTTTTCAGTTTTGTCAGTTGTTAGTCTAAAAGTGAGGAGGACGAAATCCTTGATGT TGCTAAGGAGAAATTTGCTCATTTATACTAAAGATCCGAAATGATGTATGTAAATCTTCAAAAATTAGGTAGTAATGTAT CTTAATGTTTTTTTTTAATGTTACGGCTTAGTACATCACACACTGTGTTGGATATCTTGGTATGTCGTATACACTCCATG GTAATAGCTAATCACTTAGTCCTTGGGGACACTTTATATATTGTTTTTTGGAATGGAATGGTATAAATGCCAGCCGCCAG TTGGTCCCGTTTAATCCATCCTGTTATTGTGATGCTATTGGGCTGAACAGATTTATATTTACCAAATAAACAATGCTGAA CTGAACTGAATGAAGTGTCAGCTGAAATGGATTACGTCATATTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1009: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4445431167344N43042SW3ICA1038SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8855431876947AA246139SWMFCA1616SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 4:25:35 on Mon 20 Nov 117.