CBrugiaQ_101


Sequence

>CBrugiaQ_101 (9 EST) Length=814 GATNTTTCCGGGATTCCGGGGTCCGGNTTCCGGGGTCAAGGGGACCGGGGACGTAATTCCAGTTTTCCTGGAGTCCTGGA AACCAGNTTCCGGGNGTCCNGANTACNGGAAGTCGGGTGGCNTTTGTTCGGATTGTCCAGGGGACCTGNGGCCGGGAGTC NTTTCCGTCCAACAATCCTTCATTTCCTGGGGACCTGGTTGACCTGGGTTGCNATCCTGTCCTGGTGGCCTGCAAGTCCA GGGGTCCTGGTGGTCCACTGTGCCTGGGCGGCATCTTGTCCTTGANTGCCTGTTGGTCCTTTCTCAACCCGGTGGTCCCA TTGGTCCTTCTTGAACCTGGTTGTCCAATTGGTCCTGGTGGGCATTGTTTGCAACCGATCGCGGGTTGAAAGGTCATCGG TGGTACAATTCCAGGTAAACCTGGTCCTCCTCGTTGACCAGGAGATCCTGGAGTACCGGGTACTCCTGGGGAGCCTGGTT TTCCCGGAGATCCTGGCGGACATCGGTCACCAGTGTCACAGTTGCAGACTGGCTCCACTTGACGTTCTTTTCGACTACGT GGCATTTTGTCACGAGTAATCATCATTTCAGCCCATACTTCCTGCTCTAATATGCGAAAGAGATCCATTTTGACAGCCAG AGTACCACGGATGTCTTCCATACGTTCCATCAGATATGGAATATAAAAGAAACATGTTGCAATTCCGACCACTGATATAC CGCTCGACAAACGTCCTACTGCCTTCGACATTTCACAAGGAGTACGACCTTTAGTTATCGAATGACACTTTCTTAAATAC TACAGCATGCCCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_101: (9 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4447831167680N43298SW3ICA768SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5220991289171W15127RRAMCA1260SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7472781660888AA109418MBAFCE1G06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7496821663686AA111796SW3ICA1891SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9141611912531AA273157SW3ICA2584SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
11537702246984AA509107MBAFCX7D03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12617312392927AA585515SW3D9CA062SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
12618132393009AA585597SW3D9CA283SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
12618462393042AA585630SW3D9CA357SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 13:3:59 on Sun 19 Nov 117.