CBrugiaQ_1019


Sequence

>CBrugiaQ_1019 (2 EST) Length=637 TTTGAGGTGAGTGAGCCAAAATGTTTGAATACGACCGCTTAGCGTTGGATGTCGCTGAGCAATTTGCACAAATTCGATCA AATGCAGTAGCAAATTCATCAACGCAAATTTTGGACCCTTTTAGAACTGTTAATGGATTGTGCTTTTCGCCCTCCGGCTC TGATGTTCTTGATTGCGGAACGAGTTCCGGTTATGGAAGCCCTGGAACTGGTGAAACACCATTATCAAGCCCGGCACCGC AAGTTTTTTCCTTTCCTAGTTATGTTCAGCGTGCACTTTGTGACCGGTATCGTGTGACGATTCCGAAATTGTTGCAGCAT CGCTTCCGTCCAGTNTGTCTTGTAACGACACACAATAAAAAGTCTCTTAAGTTCGGAGAACGACGAGAATTTACCATCGC AAGCAGCAGAAGAAGATGGGTTCTCCGTCGGATTGAAATTGCTCAATCTACACAGGTGCTCTTGCTCGCCGAAAAAGGCT CCCCCGTCTAAGGTACCAATGTCACATTTGTTACCGCACTGGACACTACATTTCCGATTGTCCAATGCGTTTTAACAGTC CGTACGAGGAGTTAACCCCATATCAGGGTCGGAAGAAGTGTTACGGTGAATTTCAGTGCCAACAGTGTAAGAGAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1019: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4450501182077N43612SW3ICA1178SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
13667592605297AA661253MB3D6V4F10T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 13:55:48 on Mon 20 Nov 117.