CBrugiaQ_1031


Sequence

>CBrugiaQ_1031 (3 EST) Length=487 AGGCCAAGCTATGGAGGTGTGGACGATGATGCAAATGACAGGTATAAGAGGACTGAAGAGTATGGTTATGATGGTGGAAG GACCAACTACGAGAAGCCCAGTTACGGACGTGGAGATGATGGAGAGAGGGGGAGGTATAAGAAAAGTGAGGAGCAAGGCT ATGGTGGTGGTAGGAGCAATTATGAGAGGCCTAGTTATGGAGGTGGAGATGATGAGGATGAACGGTATAAGAAGCCAAGT CGCTATGGTGAAGATGAAGGAGAAGGATATGGCCGCAAAAAATATGGAGGTGATGATTCAGACGACGATGAAAAGAAGCA CGGTTACAATAAGCACCACCAGCGCCGCCATCATTACAACGATTATGATTAAATCTTATCTGATGTTGAACTAGTAAAGA TACTTTACCCTTTCATATTATTAGTAAATAAATAGGGGTAATTGTTGCTATTCTATATGTCTTCTATTTCTTCTTATGCC TTGTGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1031: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13667192605257AA661213MB3D6V4B12T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13667702605308AA661264MB3D6V4G12T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13668202605358AA661314MB3D6V5E05T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 19:9:11 on Wed 22 Nov 117.