CBrugiaQ_1035


Sequence

>CBrugiaQ_1035 (10 EST) Length=1268 TACAAGCAGCTTTTTCATCCTGAGCAGATGGTCACCGGTAAAGAAGATGCTGCGAATAATTATGCACGAGGACATTACAC AATTGGGAAAGAAGTGATTGATTTGGTACTTGACCGCATCCGACGTTTGGCTGAGAATTGTACTGGTTTACAGGGTTTCT TGATTTTCCACTCGTTTGGTGGCGGAACTGGTTCGGGTTTTACGTCACTGTTGATGGAACGATTATCTGTTGACTACGGT AAAAAGAGTAAATTGGAATTTTCGATATATCCAGCTCCGCAAGTTTCTACCGCTGTTGTAGAACCATACAATTCTATACT TACGACCCATACTACTCTTGAACATTCTGATTGCGCGTTTATGGTTGATAACGAAGCTATTTATGATATTTGCCGTCGCA ATTTGGATGTTGAGAGACCATCGTACACAAATCTTAATCGGCTCATTTCGCAGGTTGTGTCGTCAATAACTGCCTCCCTT CGGTTTGATGGTGCCCTGAATGTGGATCTTACGGAGTTCCAAACAAATTTGGTACCTTATCCTCGTATTCATTTCCCTTT GGCTACTTATGCACCTGTTATATCTGCGGAGAAAGCATATCATGAATCTCTCTCAGTAGCAGACATCACAAATGCATGCT TTGAACCAGCTAATCAGATGGTTAAATGCGATCCTCGACATGGGAAGTATATGGCGGTATGCCTTCTTTATCGTGGTGAT GTTGTACCGAAGGATGTGAATGCTTCCATCGCTAGTATTAAGACGAAGCGTACCATTCAGTTTGTTGACTGGTGTCCAAC AGGTTTCAAAGTTGGCATAAATTATCAGCCACCTACAGTTGTTCCTGGTGGTGATCTGGCAAAGGTACCTCGTGCTGTTT GTATGCTTGCGAATACGACGGCAATAGCGGAAGCGTGGGCAAAACTTGATAACAAATTTGATTTGATGTATGCAAAGAAG GGCTTTCGTGCATTGGTATGTCGGAGAAGGCATGGAAGAAGGAGAGTTTTCAGAAGCGCGAGAGGATTTGGCAGCGAGTC GAGAAGGACTATGAAGAGGTGGGAATTGATTCGTTGGAAGGTGAAGGCGAAGGCGAAGANTACTGATTTTCAGTAGAAAT TGTTTACAACAAGTCGTGGCATTTTGTTGCTTGTTTCTTTTTGATCCTTTTCATTTGAATTTTATTTCCGTACCAAGAAT AATTTTCTGTTTATTCATTAAGCAGAAATGTCTTATCTGTTTCGTTAACAATAAACGATACGAAAAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_1035: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4451861182213N43685SW3ICA1166SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
6676591537139AA051911SWMFCA906SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7473001660910AA109270MBAFCE2B01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7620451681913AA123622MBAFCE8D10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8195981763779AA180574MBAFCF7G01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8983881892993AA257322MBAFCZ0H7T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9141571912527AA273153SW3ICA2578SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
11160622199203AA471439MBAFCX2E09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11535622246776AA509327MBAFCW1A02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11538322247046AA509169MBAFCX8B02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 4:34:5 on Thu 23 Nov 117.