CBrugiaQ_1037


Sequence

>CBrugiaQ_1037 (2 EST) Length=492 CAAGAAAGAACAGGGCAGTATCAGAATCAAAGCGCACAAAGTGCATGGCGATAAAGAAAACACGTGCCGAATTACAGCAC CGAAAAATACACGCATGACTTGTACAGCTCAGACCAAGCTTTTAAATAAATATTAACATGGTCAAGACGCCATCTATTCC ACAACCTGCAATACAAGATTCAACATTGAAACCGAGTAGTAGTGCAGTACCTTGTAAATTTACCGTTAATAATTCGAAAA CTGGAACTTCTGTTGGCAACATCCTATAGAACCCATTATTGCAACATCAAAATCCCCTGATCAAATCGAGAAAGTTAATG ATTCTGTTGCGCGGTGTAGCAAATCAGCCAGCAGATCAGCTGAAGACAGGAAAAAACGAACTGCTAGTGCCCATGTTGAG CAATCAACAGGTCCGAATGGTGATGGTGTGGNAACATCAGCAGTCCACGCATTACGTCGTTCAGAATCTTGCTTCCACTT CTCGTCCTAACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1037: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10750742113551AA430794RRAMCA1460SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10989462168116AA454447MBAFCX1G04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 14:21:54 on Fri 17 Nov 117.