CBrugiaQ_1043


Sequence

>CBrugiaQ_1043 (15 EST) Length=497 GAAAGTGAAATATGCGGTGTGGTATATGATGTAATGGAATGGATTAAAATACAAATCACATTGTCATTGTTGTCCTTTTC AGCCAATTCACCCCAATGACGAGCATTACAGTCAATTACAATGGATAAACAAATTATCCTTTAGCCAGCAAAACAATTTT AAAATTGGGTTGTGCCGAATTCGGCACNGAGTTTGAGATTAGCTTATTTTGTTGTACAATGGATAAACCAGTAAAATTGG CGAAAGTGACGAAGATTCTTGGACGTACCGGTTCACAAGGGCAGTGTACACAGGTACTTGTTGACTTCATAGACGATCCT TCAAATCGGTCAATTATCCGTAACGTAAAGGGACCAGTTCGAGAGGGTGACATTCTAACATTGTTGGAAGCAGAAAGGGA AGCCCGTCGACTTCGTTAACCTTATTGTTATAATTTTTGTTTCTACAATGAAATTTTTGGAATAAATAGTATTTTTCAAC TAAAAAAAAAAAAAAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1043: (15 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435301
217794808616R47729AS3ISB131SLBrugia malayi infective L3 JHU93SL-BmL3
281219889976H21281AS3ISB166SLBrugia malayi infective L3 JHU93SL-BmL3
343522973926R95196SW3ICA363SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5595371345358W51511AS4SLC943T3Brugia malayi L4 JHU93SL-BmL4
5930881397358W84901SWAMCA1012SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7061531592571AA072470SWAMCA1577SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7062291592647AA072546MB4SLD056T3Brugia malayi L4 JHU93SL-BmL4
7472101660820AA109350MBAFCE0H05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7524071668391AA114495MBAFCE6B03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8809101870894AA241602MBL2SJ2A10T3Brugia malayi second stage larvae JHU96SL-BmL2
8987281893333AA257817MBL2SJ3H6T3Brugia malayi second stage larvae JHU96SL-BmL2
10988442168014AA454345MBAFCX0E02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13860492660411AA680463SWAMCA3042SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
13946072675712AA688430SWAMCA3095SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 22:41:1 on Tue 21 Nov 117.