CBrugiaQ_1045


Sequence

>CBrugiaQ_1045 (12 EST) Length=641 CAATCCGGAACCTTTACGATTTGGGCGATAAGCCTGCCCAAAATGTTTTGCCCCATCCATCCATCCAGCCTTTTTGGCAA AGCGGAAGATTCAACCCGGGCCTAATTTGCCACGCAATTCCGTTTTGTAATACCATCCTTTTGGATTAAACTCCAAACTT GGGTAAAGTAAACTGCTCTAGAGCGGTTTAATTACCCAAGTTTGAGATTACAACTTACTTCAACAATGCTTTCAGCACTT ATTGTTGTTCTAATTTGCATTAATTTTGTTTTCGGAGATGAAAAAGTGATGGAGAAAGAGCAATTTTCTGTGGAAGAAGC AACAACACTCGAAGAAGAAAGTATTAGTGAAAAAGACTTTGTGGGAAAAGGTTTTTCTGTGGAAGAAACCATTCTCGAAG AAAAAAGCAGTTCCGAAGAAGATTTCAGTAAAAATTTTACCAACAGTTTAAACTGTACGGAAATTAAGTTGACAAATAAT TCTACATCTCTAGATGCAATATCTTGCATTTAATATTGCTTTAAGCTGGGCGTAAAATGATTATCTTATGAATACCAATC TAATTAACTGGTAATTTCTCAGTTTCTGTTCATTTTAATGCAAAACTTTGTATGAAATAAACATAAATTTTCTTTCCNNN N


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1045: (12 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
296627905431H35932SWAMCA212SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
3644781017405H63059AS3ISB112T3Brugia malayi infective L3 JHU93SL-BmL3
6807211547284AA054877RRAMCA235SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8712831854355AA231941AS3ISB104T3Brugia malayi infective L3 JHU93SL-BmL3
8712841854356AA231942AS3ISB099T3Brugia malayi infective L3 JHU93SL-BmL3
8982301892835AA257359MB4SLM1H8T3Brugia malayi L4 JHU93SL-BmL4
8982311892836AA257360MB4SLM1H9T3Brugia malayi L4 JHU93SL-BmL4
8982631892868AA257392MB4SLM2D6T3Brugia malayi L4 JHU93SL-BmL4
9164141917034AA275399MB4SLY1A10T3Brugia malayi L4 JHU93SL-BmL4
9164301917050AA275415MB4SLY1C07T3Brugia malayi L4 JHU93SL-BmL4
11887622289626AA542714MB4SLY2D08T3Brugia malayi L4 JHU93SL-BmL4
11938502315002AA547801MB3D6V1A11T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 18:17:52 on Fri 17 Nov 117.