CBrugiaQ_1046


Sequence

>CBrugiaQ_1046 (4 EST) Length=508 CAGGATGATGTACGGGTTGTTTGGGTAAGTTGGTTTCCCGGTGAGTGGCGGTTAAGCAGATTGTTTGGAGCTCATTTTAA TGGACCATTTACAAGCGTTAATTGATCCAAGCAAACAATTCGCGAAAGATTCAATTCGATTGGTGAAAAGGTGCACAAAA CCAGATCGAAAAGAATATCAAAAAATTGCGGTAGCAACAGCAGTTGGTTTTGCCATAATGGGTTTTATCGGTTTCTTCGT CAAGCTTATCCACATTCCAATTAATAATATCATCGTTGGCGGATAATATAAATTTTTTGATAGGTTTATTAAACACACAT ATAATGAAGTAGTGTGATTAAAATGATATTCTATGCGAGAGTTACCAATAATTTATGTTATACAATGTGTTTGACAGTTG TATCATATCTTTGTTTCTCTTTTTTTTATTTTCTCACAGTGTTTGTGTTATATAATGATGAATTGATTAAAATAGATGTT TGAAATTTCAAATAAATTATTTCGAATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1046: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5304631300213W23359SWAMCA508SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
9076561902761AA266673SW3ICA2359SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10751482113625AA430829RRAMCA1557SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11887982289662AA542750MB4SLY2H08T3Brugia malayi L4 JHU93SL-BmL4


Date: 14:42:22 on Tue 21 Nov 117.