CBrugiaQ_1047


Sequence

>CBrugiaQ_1047 (2 EST) Length=742 GAAACACAAGATTTATTTCTGGACAATTAAAANAAAACAATAGCAGAGAACTGAGAAGACCATGAACAATAAATTTCATG CAGTGACTCGCTGAGAAATACTCTGTTGAGCATTCTTGGTTGGCATAGATTGCGTTTGTGCTGGTTGCAAAGGTGGCCGA ATTGGTGCTACACGGTAAAGAGGCGAATTTTCCAGTTTCTGGCGCAAAATACCCGTTAAAATTACTTCTACATTGTGCAC GGGCATTCCACAATCCGTTAAATACTGCAAAAGATGTACATCACTGTCATTACCCAATCAGTAACAACCAATGACTCGGT CTCAGATGCAGTGTATAACATAATGTGGTTGAGGTCGGTTCCCTTAACACAGTACCCCCACCAAGTTCAATCAAAGCCAA TAATTCCTCGTAGGATGGCTCAACACTCGGAGTCAAGTAAAATGTTACATCATGCAAAAGCATTCAAGTAGAGTGCTTTC AGTAAATCGAANACAGTTTTGCTTGTTTGTNGGAGANGCCAATAACTTACCTGGGATGACGCGACATCGGTAGCCATCAC TAACCCAGTTTGGNCCAACAATAATTTTTCCCAATGCTATTGCTTCCAGAAGCTTAAGTGNACGCCACCAACTAAGTACC ACTAAATGTGTGCATTCTTGCACTTTTTCAGTAGTCGCACCACCAAGAAAACGTACTTTTCTTCCTAATGCATCCTTTTC TTCGGGAGTGAAACCGCTGAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1047: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4384931158242N37100SW3ICA613SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10774432125747AA433149RRAMCA1587SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 22:42:37 on Thu 23 Nov 117.