CBrugiaQ_1053


Sequence

>CBrugiaQ_1053 (4 EST) Length=484 CAACGATCACTATCATCAGCACCTTATCATCTATTACCATCATCCTACCTTTCTTTTGTGTGTTGCTCATTCTCATCATT ATCAACAAAACAATGAGATGATGAGTAGTCTGTTCCACGAACCTGCAGTGAAGAAGCTGCTTGGATGGAAGCAAGGTGAT GAAGAGGAGAAATGGGCAGAAAAGGCTGTGGATTCATTGGTCAAAAAATTGAAAAAGAAGAAGAATGGTCAAGGTACTAT CGAGGACCTTGAGTTTGCACTTGCAAATCCAGGATCTCATAGTAAATGTGTCACAATACCTCGATCGCTTGATGGGCGAC TTCAGGTTATCGCATCGAAAGGGACTTCCGCATGTTATATATTGTAAGGTATGGCGGTGGCGTTAATTTGCATCGCATCC TGANCTCAGTNTTGTGCCCGAATGTTTTATATTCCTATGAAAACCAACACCCCNAATTTGTTTTAATCCCTATCCTTACC CAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1053: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281854890038H21343AS3ISB350SLBrugia malayi infective L3 JHU93SL-BmL3
8640401845488AA224704SW3ICA2073SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8986621893267AA257777MBL2SJ3A12T3Brugia malayi second stage larvae JHU96SL-BmL2
8987351893340AA257824MBL2SJ4A1T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 22:0:50 on Fri 17 Nov 117.