CBrugiaQ_1054


Sequence

>CBrugiaQ_1054 (5 EST) Length=490 TTTNGGNGGTATGGAAAATTTATTGATACGAATTATAACAGGGACGAATGTAGATTGCGGGAGACTTGGANATTTCAAGG CATGTTACACCTTCTACATAACGAGTTATGTGAATATTGGACCACGTGCATTTTTATAGTCTAGGAGTAGGCAGCTATTG CCGATCCTTTTTTCTAGCTGGGTAACGCCACCAATATTCCGCTACTGCCGTGTCTTGTATTAAATTCCCATATATGTCAT ATTTTACAACTTCCACGCGATGTAAATTGACAAGAACGTATAATGGATAACACCAGAAACTGGCACCCCCCAAAAACATG TGTCCACTTTGGCAGTTTCATTCCTGCAGTTGGTACATGGAACTTTCACACGTTGTTAGGAAGAGATACAATATTCAGAT TGCCTTGTCGGAAAAACAATGCGTCCTCAATAAAAGCGCCGTACTCCTCCACTTCAGTCTAATTTAATTCAGCACCTGGA ACAATATCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1054: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4446621167463N43161SWMFCA362SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4459551182972N44453SW3ICA1318SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8855391876943AA246135SWMFCA1612SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9139531911877AA272950SW3ICA2387SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
11160642199205AA471441MBAFCX2E11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 19:45:0 on Fri 17 Nov 117.