CBrugiaQ_1060


Sequence

>CBrugiaQ_1060 (9 EST) Length=1148 CGTAGCATAGCTTCTCTTTNATGTNACGCACAATTTCTCGTTCAGCCGTAGTCGTAGACGAGTAGCCACGTTCAGTGNGG ATCTTCATTAGGTAATCTGTCAAGTCCCGTCCAGCCAGGTCCAAACGTAAAATTGCGTGTGGCNATGCGTAACCTTCGTA AATTGGTACCGTGTGAGTAACACCATCTCCGGAATCAAGCACAATACCAGTGGTACGGACCGGATGGCGTACAACGACAG AACAGCTTGGATGGCAACGTACATAGCCGGAGTATTGAATGTCTCGAACATAATTTGGGTCATCTTTTCTCTGTTTGCCT TTGGGTTCAACGGCGCTTCGGTAAGCAGTACTGGATGTTCCTCGGGAGCAACTCGAAGTTCGTTGTAGAAAGTATGATGC CAGATCTTCTCCATGTCATCCCAGTTTGTGACAATGCCATGCTCAATTGGATATTTTAGTGTTAGAATACCTCTCTTCGA CTGAGCCTCATCGCCTACATATGAATCCTTTTGACCCATACCGACCATGACACCTTGATGCCTTGGTCGTCCAACTATTG ATGGGAATACAGCTCGAGGTGCATCATCACCAGCAAATCCGGCTTTGCACATACCGGATCCATTATCTACTACTAATGCT GCTACTTCCTCGTCGCACATTATTTATAGCTTTTTGAAACTGAGAACTGGAGCGTCGGTGAACCGCAATTCGGCACGAGA GAGAAACTAAGTCGTCGTCTCTCGTCCTATATGCCTCCGTACTTACTGGGGTCAGGATCAGGATCAAGAAATTTCCTGAA CTACGATTCACATTATTATACTGCACCTTTCATTGCACAGTCATACGGAGCACCTATTTTTCATCAATCAGTCAATTCGC TGCAACACTTCAGTGGCACTGATTCCGGATATATGACCAGTCCGGCTGATTCCGAACGATGGCGAACAAATAACTGGGAA ATCGGGAATTCTCGTTTATCTCTTAATGAAGCGTTTTTTGTGGATGATTCACCTGGAAGACCATCGACGATAGTTCCATT GNCAACAATTATATCCATCCCGCCGCCAACTCTAAAACAATTCAAAAAGTTGCAAAAAAGGCACAAAAAAATGTTGAAAA AAATGGGTTCTGTTTCGGCGAATCTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_1060: (9 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291615902147H30991SW3ICA245SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
6000841416507W91827SWAMCA968SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6186101463711AA007706SWAMCA796SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6675181531528AA051822SWAMCA1452SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6676291537109AA051942SWMFCA827SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7244791631389AA088162SWAFCA030SKBrugia malayi adult female cDNA (SAW96MLW-BmAF)
9076531902758AA266670SW3ICA2356SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10751252113602AA430806RRAMCA1527SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11161752199316AA471552MBAFCX3G08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 19:14:32 on Sun 19 Nov 117.