CBrugiaQ_1067


Sequence

>CBrugiaQ_1067 (3 EST) Length=495 ATATTTTTCTCTTGTTTCATCTCACGTGGCTTTCGAGTTGTCCGCGTAAATGGTTTGTGTGTAAATAACGGAACTTTTTA CGGAACTGAAAAGTTTAAGATGGCATTCGAAAACTTCGGTTTTAACTCAATACCGTCCTTGCTTGAAACTATTCAGCAAC GCATTGTTGAAATTGATGCGAAAAACGAAGAGCTTGAAGAAAAGATATCGGAGTTTGAGCAACGCGCCAGAATGGATGTA CCGAATAACCAAGAAACACCGGAAAACATGCAGCAAAATCAGTCGGATGGTAGTGATTCGGATGAAGAAATTGAAGAATT CCTGCGTGAGTTGTACGCATTTAACGGCGANGCGNAGGCGAACGGATTAGCACCAGCGGATGCAACGAACGCAGCGGATG CAACAAAATGCAGCAGTAGTTTGCACAAAATCATCATGAGAACTTGACAACAGTAGTGCACACCTGAAACTGTCAACGTG CTACCAAAATATCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1067: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4451411182168N43588RRAMCA078SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6675101531520AA051814SWAMCA1443SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10614732078623AA417439RRAMCA1442SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 2:19:32 on Wed 22 Nov 117.