CBrugiaQ_1068


Sequence

>CBrugiaQ_1068 (3 EST) Length=482 CCAAGTTTGAGATTAGTAATAATGGCTGGCAGACGCGATTGTCGTGTGTTTGTAGGCAATTTGCCAAGCGACGTGAAACA ACGAGATCTGGAAGATATTTTCTACAAGTACGGACGCATCAATTTTATCGATATAAAGTTTACAAGAGATGTACCTTTCG CATTTATTGAATTTGATGATCCCAGAGATGCTCGAGATGCTGTTCACGGTCGAGATGGATATGACTTTGACGGGTGTCGG ATCCGAGTTGAATTAACTCGAGGAGTTGGTCCGCGTGGGCCAGGTGGTCGGCCGTTGTATGGACCGGATTCGCGGTCGCC TCGACGTGGCCCGCCCCCTCGACGAAGTGGATATCGTGTCATAGTTTCAGGCCTTCCCGACACCGGCTCCGTGGCAGGAT CTTAAAGACCATATGCCGTTGATGCCGGTTGAAATATGCTATGCAGATTTTTTTCCGANATGGCACTGGTGTTTGTTCNA AN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1068: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291566902098H30942SW3ICA185SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
6186341463735AA007730SWMFCA405SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10797432140363AA435449SWAMCA1581SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 8:20:21 on Thu 23 Nov 117.