CBrugiaQ_1073


Sequence

>CBrugiaQ_1073 (8 EST) Length=518 ATCATTCTGTCACAATTCAATTCATTTATTCCACTGATATTATACAATGCGGATTGAATTCAAATGATTACAATTGTGAT GCAACATTATGCATTTTTATAAGTTATATTCGATTGGAAGGTTCTTGCGACGAACCATACCATCGCCCTGGAACCATTCG CGGCGGAACTGTTTCGCAGCGCCATCCGGTGTGTTTGTCCATTCGATGGTAATACGATCGTTGTTGATGTCTTCCTTCGA TGCATCGAATGTGTCACACGAGACCGCCATGAGAACATTCTCCTTTGGGTCCAGGACGCCACATGGTGGGTCAACACCTA GACGGCGCATATTGGTCGTTTTAATAGCCCAACCAATGCGACGACCACCGGCATTAGTAATCTTAATGTGATATGTATGT TTGTCATCGTACGGGGCATTGAAGACAATCTTTGACCCCGGTTGGGTATGGATATCACCCGGTGGAATCGACTGCGCCAT TACGAAGAGGGAAGGTGCACTACTTTATCCCAGCAGCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_1073: (8 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4621671199682N56590RRAMCA103SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5072371271721W00307RRAMCA1116SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5930891397359W84902SWAMCA1013SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6825821549410AA056780SWAMCA1511SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10429862055217AA401616SWAMCA1679SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10774712125775AA433177RRAMCA1623SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10774742125778AA433180RRAMCA1626SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10797672140387AA435473SWAMCA1716SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 10:42:22 on Mon 20 Nov 117.