CBrugiaQ_1077


Sequence

>CBrugiaQ_1077 (2 EST) Length=493 AATCATATCGGACACACTGGATACATCAACACAGTTACTGTATCGCCGGATGGTTCACTTTGTGCTTCGGGCGGAAAGGA CGGTAACGCTATGTTGTGGGATTTAAATGAAGGAAAGCACTTGTATACTTTGGGTGGCAACGATGTTATCAATGCACTGG CATTCTCACCTAATCGCTACTGGCTTTGTGCTGCAGTTGGACCTGTGGTTAAAATTTGGGATAACGGAAGATAAGAAACC TGTAGATGAATTGAAGCTGGATGTTATGGGTGGGGCCAAATCTGCACCTCCACAATGTATTTCGTTAGCTTGGTCAGCTG ATGGTCAAACACTTTATGCTGGATATACTGATAATGTAATTCGCATATGGCAGGTTTCTGTTGCCCAAATTCGATCATAA TTTATGTAGTTGTTATATGTCAGGTAAAACATACTTGTTATGTGTTCTGCAAAAGTGACATGTGAACATCTCTTATATTA AAGCATTGAATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_1077: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12139152334997AA563532SWMFCA2494SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
13813132655433AA675727MBAFCW4A11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 23:16:17 on Fri 24 Nov 117.