CBrugiaQ_1079


Sequence

>CBrugiaQ_1079 (2 EST) Length=536 TTGGACGCTCTCGTGCAAATTTACCATTCCAACCGATCCTTGGTGAGTAATTCCATGTCGTACATTGTAAGGCTCATAAG GATCATCGATATAGTATTTCGGTCGTAACCCAAAATGGTGTCATCATACGATCTAGCATCCAGCATTCCTCTTTTGTACA TGTCTCATAATAGTAACTTGTCTTTAAAAAGGTTTCATCTTTTTTATACCGTTTCACATTCCTTCCCATTTGTGCACGTA TCCACATGCCGTTATTAAGCCGTTTGAAACGATCCAGTACATCCTGACACGGTCTTTTGCGCCCTTCTTTTGGATCAAAC CTGATATGATATTCCCAATGCGGTATCCTTGCAATACCACGTTTCGTAATCTCGAAACCATTTTTAACCGCCAATGGCAC CACTTTACATCCATTCAACAATATTGTCATAGTAGAACAAAACCTTGAAAAAACACTTCCGCTACTTCACGTTTCAATAA CACGTCACCATATCTCAAACTTGGCTCGTGCCGAATTCCTGCAGCCCGGGGGATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1079: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5679021366650W59912SWAMCA962SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
13669192605457AA661413MBAFCW3G01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:2:27 on Fri 17 Nov 117.