CBrugiaQ_1082


Sequence

>CBrugiaQ_1082 (6 EST) Length=486 ATTTTATTGTTCTGANCCATGCAGCCGTCGAAGTAATACTGGGTAGTATCAGCTGCAGTACAGAAAGNTGGTTTTTTAGG TGGTTTGGGGGAATTCTTTTCTGCGAGAGAAGAAAAAATCTTGGANCCTTTCTCGCTGTNCCGCGCCAATTGCCATCCNT TACGTCTCTCTTCTAATGACGTCACCAAATCCTCTTTGTATTTATTTGACTCTTGGACATATCGTGATAATTCTTTTTGT TCTTCGGCGGTCAATTCTCGAAGAGGTAAACCATTCGCAAACAGTTTGTTGTCAACGACCACACATCCGGCTGTTCCACC AATTCCTGCAACGTTGAATCCAGCGAAGCGTTTGTTATACCTTTTCACTATACCTGCTTCCAGCACTGCTATCGCGAATA ATAACAAACAAAAAAGAGTCTTCATAGTTATCTTTGAAGTCAGACTTGTTGCTGGATTATATAATCACGATTCTCAAAAC TCAGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1082: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291604902136H30980SW3ICA229SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
354111992885H52889SW3ICA433SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4459311182948N44429SW3ICA1239SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4706501215781N64899SW3ICA1364SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10751502113627AA430831RRAMCA1559SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
13813582655478AA675772MBAFCW4E12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 0:49:1 on Wed 22 Nov 117.