CBrugiaQ_1083


Sequence

>CBrugiaQ_1083 (4 EST) Length=926 CAATCCCCATTTCGCTTATGCTTTTTGTTGAAGCTTAATTGCTTCCTACGAATTCTAATACGGATATGACATTCCTGGTT GATTAGAATCATTCCTGAAGTTAAAAAACAAACCTTGTGGCTATTATAGACTTCGAAGTGTACTCAACTTTATGTAACAT AGTATCAGCTGGCTAATCCACTCAACCAACATAGCATCACTCCGCCAATATTTATTTCTTTTCTTAAAGAAAGGAAACAG TATAGATGAATGCTTGATCATGAAGAGAATCGGCAAAAATAAAAGAAGAAAAGAAACAATGATCGACAAACTGCACGAAG ATTGCCTCATATCCATATTCCAGAAGTTGGACTTCATTGATCGCGTACGTCTTGAGGTCGTGTGTCATAAATGGTTCGAA ATACTACAGAAGCAAGCAACTTATGCGAACATTAAAGAATTGAATATGGCTGATTTTTTAGTAAATAATTCCAGTGGATA CTTTCAGNAGGAATTCATCTCATTCGCACCAACGGTTATTGGAGTGGTAAAACGTTGCGGACGTTACGTTCGGATTGATC AGTGTGGGTCAACGATGGCTTAAAATCTCACAGCCTATTATGGACGCTATGGACGATTATTGCACTCGTCTAACAGAACT TGATCTTGGCTGCATTATGTTGGATGCTGATATATCCATCTTATTGGAGAAGACTGGCGAGAATTTGGAAATATTTTCAT TGGAAGAGACTAGCTGGGTGAATAAAGATGATGGCGATAAGGTGCAAGATTTCTTTCAGCGAATGAAAAGATGAATNAAA TCAATCTCAGACGAGCTTCATTTATACTGAACAGATTCACGAACTTCCTCCTGCCCAAAAGGATTGAGATCANNGGGGGG GATTCACTTCCAGGCGNAATCTTAAATTTATTTCTCGCCNACATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1083: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291535902067H30911SW3ICA123SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
320187944803R86397SW3ICA346SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4425451164693N41095SWMFCA265SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10860072153591AA441713SW3ICA2531SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 11:52:11 on Thu 23 Nov 117.