CBrugiaQ_1088


Sequence

>CBrugiaQ_1088 (3 EST) Length=482 GTTGCATTGTAACATCTGAATATGGATGGTCTGCCAATATCGAGCCGAATTAGGAACGAGCGCAGGCACTGCGGGATTCT TCTACAATGGGATATATGGCTGCCAAAAAACATCTCGAAATCAACCCTGACCATTCTGTTATCAAAGCGCTGCGAGAGCG TGTCGAGGCAGACAAAAACGATAAGACTGTGAAAGATTTAGTGGTTTTGCTCTTTGAAACTGCCTTGCTTTCTTCTGGTT TTTCGCTTGAAGATCCGCAGTTGCATGCATCAAGGATATACCGCATGATTAAGCTTGGGCTTGATATTACGGAGGATGAG GAAGATGAAGCAATTGCATCCGTTTCTGGTGAGAAAGACGAATGTGTGCCAAACTTAGTTGGTGCCGAGGAAGATGCATC GAGGATGGAAGAAGTTGATTAATTCTCTCATTAAATTTTAATAATGTTTCAATTCAATATGAGTCAAATTGTAGTAAAAT TA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1088: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8196621763843AA180651MBAFCG1F01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10482902064937AA406945MBAFCZ7B08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11536892246903AA509026MBAFCX6D06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 10:29:59 on Sat 18 Nov 117.