CBrugiaQ_1090


Sequence

>CBrugiaQ_1090 (2 EST) Length=560 AATAATAATAATAATAATGAAAATACTAATAATGACAGTAACAAGAAAAATAAAAAAAAATAGTAATATTAATATGTTGC CATCAAGAGGGACGCACGCAATACTCCGCTAATGGTTTGATCAAACCGTCATGATAAGCGCGCAAAATACATTCGCATAC AAATGTATACTGACCCGGTGTTTGTATGAGCATAGCCCGCTGATCGCGCATTGTTCTAACAATATCTAGGGGATACACCG GTTCATTACCTTCTACCAGACAAGCAGCTGTTTCCATCAGTATTAGCACACCGGTTCGTCCGATTCCTGCACTGCAGTGC ACAACGATTGGATCTACTGAACCTGCTCGTGCACGTCGAACTTCATCGACGAAATCAATAAAATGTTTCGGATCATCTGG AACACCATGATCAGGCCACGCCGTGTACTGCATTTGGCTTACCCGTCTCTCTTCTTTTGTCATTATATCTTGAATCGTGA CATTTCGCGATAAACGCAGTTAGCAGTTTCTCGTTCACTAATACAAGAAATTTGCAATCGACCATAATCGTGATTTTCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1090: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8983611892966AA257490MBAFCZ0E10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13247752539418AA627031MBAFCW2G01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 13:38:44 on Fri 24 Nov 117.