CBrugiaQ_1091


Sequence

>CBrugiaQ_1091 (2 EST) Length=480 GTGTTTGCAGGTTTTGAACGATTGTAGAAGTTTTAACGTTTTTAACACCAGGAAGCAATTTTGGGGAATCAACGTGAGCA GTTATTTTGTTATTTGTGTCATCTGGTTTTTGGTCGTTGCCCGACGACGGATTTTATGAAGACTCTGGGGATATAGATTT CCGCACGAAAATAAGCATGAAGTTATACCGTGATGATTGTTCGTCGGCTCTTTGTCGTCTGGATGGATGGACTTGTGTGT TTGCTCGGATCATATCTGCTGAACCTCTGGAAGTTGGAAGATGGGACAGGTCGCCTTTTATTAAACAGAATTGCTGAAGA TATATCTATTGAAGATGTTCACTCCAATGATTATTGCTATCTACTGCTANATACCACTGTTCCGACCGATTCNAATGCAT CCCGTATCCCTGTTTGTTTCCANTTTGAAAATTGCCCCCGCCTTGCTCCCCTAACCANCCTGAACCTTGGTTTCCCTTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1091: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6807191547282AA054875RRAMCA233SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
9076651902770AA266682SW3ICA2368SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 21:33:50 on Mon 20 Nov 117.