CBrugiaQ_1098


Sequence

>CBrugiaQ_1098 (2 EST) Length=512 TCATATTTATATGTCCAGCAAGCTGAACAATCTCTATGCTCGATAGCTGCTACAATATAGCCATGACTTGCCAGTGATGA ACAATAAACTGAATAAAAGTGACGACATGCTGAAAGGCCATGAGAAAATATCAGAACTGGATAGTTTGCTATACTCTTAT TTAATGCAAGATGCCGACGAGCGGGAATCCTTTTTTCTCCAATAAACCATCTGTGGGAATAAAATGCATCCAGCGAGAAG ATGAATTCCGATAGTCTGCTAAACCATCTAAATATTCTTCTCTCGGAAGCCACAAGGGATGTTCCGATTGTTCATCTGAT CTGGTTGCACTATCGCATGGATAGTAGATTGTTAACAGGATGCCAATATCATCACCACTTGCACTATCACTATCGCTGAT CATTATTTCGGCACATCCTACATCAAATTTTCCACTTCCATAACAAGAGAGTACAGTGGAATCTTTTTGCATCGATGTTG AGATGCCCATTATGATAGAAACTNCAAACNTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1098: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8249171769746AA185858SW3ICA1961SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9245971926199AA283505SW3ICA2627SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 22:32:34 on Tue 21 Nov 117.