CBrugiaQ_1099


Sequence

>CBrugiaQ_1099 (15 EST) Length=835 NGNCCACCGCTGGTGGCCGGCCGCTCTAGAAGCGGTTTAATTACCCAAGTTTGAGTTCTACTATCAAAAAAATTTTATCA AAATGTCTGCACAACTTTTGATTTTATCACACATGGTGTTATTGCAACTTATTGTTGCACAACTAGGCCCAAAAATTGGC AAACAGTTCTTAAAACCGAAGCAATGTGAAATAACGAATCAAACAGTGTATGATTTTCAAGTTCAAATGCTAAACGGTGC ACAAAAAAGTTTGGCAGAATATCGCAACAAAGTTCTTTTAATCGTTAATGTCGCTACTTACTGCGCATACACAATGCAAT ACAGAGATTTCAATCCAATACTTGAAAGTAATTCTAATGGAACGCTCAATATCCTAGGATTTCCATGCAATCAGTTTTAC TTGCAAGAACCAGCAGAAAATCACGAGTTGTTGAGTGGTTTGAAATATGTAAGACCAGGACATGGCTGGGAACCACACAA AAACATGCACATTTTTGGCAAACTTGAAGTTAATGGTGAAAATGATCATCCGCTTTACAAATTTTTGAAGGAACGTTGCC CGCCGACAGTGCCAGTAATTGGAAAGCGTCATCAGTTAATATACGATCCCATAGGGTACAAATGATGTTATTTGGGAATT TTGAAAAATTCTTGGTTGATAAGAAAGGTCGTCCACGTTTACCGCTTTCATCCCGAAAATTGGGGTTCAAGGAACTGCTG TAAAGCCATATATCGATGAACTGGAAACGTGAAATTTAACGTTATTAACCTGGTCACCTATTACAAGTTGTAAACTTCTT GCCATTTTTATTTCACAATAAAGTCTGCAGTCTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1099: (15 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435308
217749808571R47684SWAMCA140SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5305251300275W23421RRAMCA1303SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5441751318069W36323RRAMCA1360SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5477001322254W39848RRAMCA139SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7062121592630AA072529MB4SLD047T3Brugia malayi L4 JHU93SL-BmL4
7566751675192AA118251KJ4SLB213T3JHU93SL-BmL4 (JHU)
8982881892893AA257254MB4SLM2F9T3Brugia malayi L4 JHU93SL-BmL4
9164321917052AA275417MB4SLY1C09T3Brugia malayi L4 JHU93SL-BmL4
9164891917109AA275528MB4SLY1H08T3Brugia malayi L4 JHU93SL-BmL4
10312252042861AA389875KJ4SLB294T3JHU93SL-BmL4 (JHU)
11161902199331AA471567MBAFCX4A02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11888002289664AA542752MB4SLY2H10T3Brugia malayi L4 JHU93SL-BmL4
12652042402575AA588912KJ4SLB357T3JHU93SL-BmL4 (JHU)
13669142605452AA661408MBAFCW3F08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 18:53:55 on Sun 19 Nov 117.