CBrugiaQ_110


Sequence

>CBrugiaQ_110 (7 EST) Length=746 AATTCTGATTGTATGGTGACGGCGAAATCAGTGAGCTTCGACTAAGTCATTCACAATGACTGTGGAGAACAGCAATTTGG AACACGAGTGTCACCTTTTAAATCAACACGAACTTTCGAGATCACAAAAATACGAATTGCAACGTTTCATTGATCAAAAT TCCCATCTTCTACGTTCACCAAGTTCACAAGGAACAGGTGACTCATCAATTTGGACGAAAGATAAAGGAGAGGATCGATC CAATCCGTATCAGCGAAACTACGGAACGTTATCCATATCATCATCACCACCCAACAGAAGTAGTAGGAAGGAAGTAAAGT GGTCAGACGACGTGTACCAATCAACAGGACCAATCCGTCAAACATCTTCATTATCACCGAACTGGTCTACAACGAACAAT CATTTGAAAACTTCCGACAGTTTCGACGATTTTTATAATTTGTATAATAATTACAACAGTGGTAATAGCAGTAGCACAAA CNCNATGTCNTATTATGGCNATACTGGAAACATAAATAGAGGTCGTGATAATCACTTTNCCGGAATATAGTCCAACTAGC AATTATCAATCATATGGGAAAGCATCCGGAGGATTATAATCCGATATGAAACAGCACGTTCTCGAAATTCTTACTTTACC ACGACAACGAAGAAGATGATGAAAGGGAGTCCAATTTCCCGGGAATATGGTGAATCCGAACCGGGGTCCTGGGGTTAAAA TTTAAGCCCCCAAAATTGGCTTGGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_110: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4447551167652N43270SW3ICA706SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4458701182887N44368SW3ICA1206SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4459001182917N44398SW3ICA1266SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7061641592582AA072509SW3ICA1515SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7155581619229AA080320SW3ICA1568SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10777552130938AA433461SW3ICA2350SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
11253272209395AA480697SWMFCA2043SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 12:33:58 on Tue 21 Nov 117.