CBrugiaQ_1105


Sequence

>CBrugiaQ_1105 (3 EST) Length=498 AAGTGACACGTTGAACATGGAAGAGTGAGTTTTGTGGCTGAATGTGCTGTAGAGCAGTGTCATCGGTAACGTTGACACAT TCGAGCGATATCCCACGTGTGCGTCGCTTCCTTACTGAATTGATGCGATTGAGGCGTAGCTTTCGTGCTGAATTCCACAT CGCTTTTACATGCCAGTACCAATGCCAATAGATATACAACAGGAAGAAGTTCAGTGATGCGCCAGTAGCATAAATAGACA CCGATAAAAGTGAAGCACTGTTCTGATCACCGGTAAATGTCGGCAAGACCTCGGTAGAGCAGCCAAACTTAAAATCAGCA ACCCGACCCCATAGGCACTTTGCTGGATAAGAAGAGGCCATAATGAGTAAGGCCTTGGTCTTGATACGAATGCAAATGGC AGGCATATGGCAAAGGTANAAGAATGTGACAAACACACCACANGAACCTTCCATATCCACCGTCCAGGTGCTGTGCTACG CAACTGGCNAGGCCCCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1105: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3657971019970H64209RRAMCA002SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6675171531527AA051821SWAMCA1451SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7523651668349AA114514MBAFCE5E04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 21:5:10 on Fri 24 Nov 117.