CBrugiaQ_1108


Sequence

>CBrugiaQ_1108 (2 EST) Length=502 ATGATTTCCAGCTACAACTATCTTATGTTTATGCGGTAAACTACCAATTTGGGCATTAAATTTAATTACTTCACCAATAT CACCATAATTTGTAAAATCACCAGCATGAATGAAAATATCACGTTCCGGTATTACGGATAATACTTCTTCCATTTTTTCA TGTGTATCCGAAATACACACAAAACGTACCTTATTCTCAAAAATTGGTGTATCAAGCCTCAATGGCTTAACAGGCTCAGA AATGNGTCCCTGTTTCAAATATTTGCGCCATAATTCGACTGGTTTATGTGATAATGGATCAACTGGGACGACATTTCGTT CCGCCATATTTTCTTATTAAACTTTTCTTTCTTCCTTTCTTTTTTTCTTCTTTTTTAAATCAAATTTTAACAGCCCTTTT TTCAGATAGAAAGAATGTGAAGATAATTTCTCATTAGTAAAATATGATGGTAAACTTTGCGATAGTATTAATTTAAATAG TTCTTTCTTTCTTCCTTTTGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1108: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435304
8197321763913AA180695MBAFCG3D03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 1:10:42 on Mon 20 Nov 117.