CBrugiaQ_1114


Sequence

>CBrugiaQ_1114 (7 EST) Length=793 GCAATATGAAGATTTTATTTGCTATATATATATACATATATGTATACACAACACTACAAGAAATACGAACTACGAAAATG CTAAAGCAATGAACAAAAACGTTATACTACTATTTTTCCNTCAACACTACTCGATTTNTCCTGGGCGGCTCTTTTACGAG AAGCTCGTTTCAATAACCGTCTTTCTCGTTCGAATTCTTTCATCCTCAGGAGATGATCTTCATATTCACAATTCTGCCAT CCGTGGTAATCATCTGTGCAGTAATAATGCGAAAAAGGAGCATACTGTCGCTGGCATTTTTTGAGATTAATTAGTAAGTG AGCACAGTAATCACGATCGCCGAATTCTAGTTTCCAGTGATCCATTTCCTCCCATGTTGCTTTCATTTCACGCGGTTTTC GTCCTTTAGGAAATCCATAGAATGGGTCAAAAGTGGGAGGGCGATCCGTTCGAGGTGAGACTTCCGGATCTTCCAGTGAT ACAGATAACCGGGTACCCATTCAGTCTTTTACCATTAACTCAAACTTGGGTAATTAAACCCGGAATTCCGGGTTTAATTA CCCAAGTTTGAGCAGAAAGAAAGAATGACCAAGGTTAACGCACGAGATGTAAGAGGAAAAAAGAAGGAAAAGCTAACGAA ACAACGTTGATGAACAAAAGACGAGAACTTGCTTCACTTAGTATCAAAATGAGTCGTGTGAGCCTTTCGACTCAGATCGT CATTCGTGAGCATCCAGATTCAAGTCATCATACCAAGACGACAGAACTAGAGTCTAGAGCATCCACTCGATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_1114: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217797808619R47732AS3ISB125SLBrugia malayi infective L3 JHU93SL-BmL3
4459451182962N44443SW3ICA1302SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5304941300244W23390SWAMCA716SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8678811850646AA228540KJ4SLB324T3JHU93SL-BmL4 (JHU)
8810731871057AA241531MBL2SJ9C2T3Brugia malayi second stage larvae JHU96SL-BmL2
11536962246910AA509033MBAFCX6E01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13668372605375AA661331MB3D6V5G03T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 13:9:46 on Sun 19 Nov 117.