CBrugiaQ_1120


Sequence

>CBrugiaQ_1120 (2 EST) Length=499 ATGGGAAGTACACTACTTAAATAACTTGCAACAGAACTGTCGACTTCGGAAGTTATTTGTTCAACAATATCATCAGGAAA ACTTTCGCGCTTTCGAAGCTCTTCCAAAATTTTTTGTATGCAGCTATGATACTGCGTGCCAGACTGCATGCGAATTCTCA TATATTTCTTGAAGGCACCTAAACCACCCAATTGCTTTATCATTTTCAATTGCCATTGATACAGCAAATGTTGTGAAGTT GTACATCCTAGAACGGTTGAAACCGATGGATAACGACCATCCTCCACATTTACTGTGTTTTATAGAAATTGATTTGTTTT AACGTATGATAATTTCTGACGTGTAGCTAAGACTGATGGAGGAGAAGTAAGAAAATCTTTCGTCGGCAAAGTTCCAAGGA TATTTTTAACAACAGTTGGCATAATTGCAGTACCATAATGAACCGTCTTTACACCAACTTTGCTTGCCATACTCAAACTC GTGCCGAATTCGGCAAGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1120: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8001661737549AA161526MBAFCE9G07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10483552065002AA406984MBAFCZ7H08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 15:53:17 on Fri 17 Nov 117.