CBrugiaQ_1123


Sequence

>CBrugiaQ_1123 (3 EST) Length=716 CATTNGGTTTATTTTTTTCNGGGCGCAAATGCCATAATTCGTTCGCGTCCAAACAAACGTGCAAAGAAATAACATATCTG TGCACCACAAGCTGGAACACGTACAAACTAGAAATAAAGCAATTGGAAATGAAAATAAATATCCTGAAAGAACAGTAAGG AAAATTGAACCAGGAATAGCTAATGACTGCAACATGATGTATACAGTTGATATACCAAATAAGACAGTATAATAATGTTT GTCCTTATACTTTGAAAGAACCAAACCTAATCGTTTTGCTTGCTTTAGATCTTTTGGTAGTTTGAAATCAACTCTTTCAT CGTCAGTAAGTTCCGGAAAGTTGATATACAGCATGAACAAAATTAAAAAAATGCTGAACAAAATACATGTTAGGAACACA AATTTGCTAAAAGCCATATCAGCAACAATATTTGCAATCCGATGAAACGTGTTAGTAATATATGTAATGAAATAAATAAA AGTTTCCCCTCAAACCTCGTGCCGAATTCGGCACGAGAAGACGTTCACTTCATTTGCCTTTGAATAAACGTGAACAGTTC GTGAAGTTTCTAAGAGGTGACGAAGTGGCGGTCTGCGAGGAAGTGAGACAGTCATTGTTTCACGAATCTCGTGAGGAAAC ATTCACGAATTATGCTCGTATCATTATTGTTAATTACGATGAGTCATATGGCAGTATTAAATTAATTCGACAAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1123: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4450631182090N43625SW3ICA780SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7620921681960AA123665SW3ICA1711SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10481262064773AA406716MBAFCZ4E12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 0:53:5 on Fri 24 Nov 117.