CBrugiaQ_1127


Sequence

>CBrugiaQ_1127 (2 EST) Length=480 TAGATAAATATTATCCATGAAACTACTGTGAGAGGCAATATCCATTTTCTTCTTATGAAAGTGATTGAACGGAACAATGA AAAAGAGAAATAAATTGGAAGCACTACAATTAATACAAAAAGTATTGAATAAAGTCCCAACTTCCAGTGCAAAAATCGAG AACTCGGTTCTAGGAAGCCAATAATTTCAAAAATAATCAGTTCGAACATTGTGCAAGATAATGCAAATGTAATCGAAAAT AATATCTGTACAAGTCTTTTGTGTACTTCATAATCACGAAATAACTGCTTCATGAAGAAGAACCATCCAAACAAAAAGAA AACTACCTGAGACAGTAGCATAACAACGGAATCCCACATCAGAGTCATGCGAGACGTTCAATTTCCACAAATCAAACATC GGCTGCCAGTTTTTCGTCAACAATACTTTCAGGTTTCCGCTGTCTCGTTTACGATTGATTCTTTTGTCTCCTCAAACTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1127: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7473281660938AA109442MBAFCE2D08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11161852199326AA471562MBAFCX3H08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 0:34:6 on Thu 23 Nov 117.